answersLogoWhite

0

What is faster lambroghini or Ferrari?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/18/2019

It depends what Ferrari and what Lamborghini.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is faster a lambroghini reventon or a buggati veryon?

they are the same. they both travel 211 mph


Who has faster clutch systems Lamborghini or Ferrari?

ferrari is faster


Which is faster ford gt or Ferrari enzo?

The enzo ferrari is faster


Which is faster a Ferrari 599 or a Lamborghini Gallardo?

The Ferrari is faster by 3 mph.


Which is faster- Ferrari or Porche?

In some cases the Porsche Carrera (Spanish for race) is faster than some Ferrari models but generally Ferrari is faster


What car is faster lamborghini or Ferrari?

Ferrari


Who is faster Usain Bolt or a Ferrari?

A ferrari


Is a Lamborghini Countach faster than a Ferrari F50?

No, in this case the Ferrari F50 is faster.


What ferrari is faster than ferrari fxx?

none


Which can go faster a ferrari or Mercedes-Benz?

FERRARI


What is faster a Subaru or a Ferrari fxx?

it depends on what suburu it is. The ferrari fxx is probably faster though


Is the Lamborghini Diablo or California faster?

If you mean Ferrari California, then a Diablo is faster. A Lamborghini is faster than a Ferrari California

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.