0
What else can I help you with?
Related Questions
Is their going to be a Sly4?
yes their is a POSIBILITY that their will be one
Is sly4 on PS2?
No it is not
Where will sly4 be released?
yes
When will sly4 release?
around 2009.
Is sly4 good?
of course its good
Why is sly4 not on PS2?
Beacase there's a ps3. Sorry.
When is the game Sly4 coming out on the ps2?
Yes,in 2011 may 22
Why do sly4 have to be on PS3?
because sly has always been a playstation exclusive
Will Sly4 be released on playstation2?
yes i hope so it will be now on ps3 and ps2
Will sly cooper 4 be released for ps2?
It does not come out for the PS2 under any title and might come out for the PS3 under another name but will never be released as SLY4
Is there going to be a Sly4?
Yes there will be a Sly 4 it will come out but nobody knows when exactley because Sucker Punch is working on inFAMOUS. It will be called Sly 4 King of Thieves. It will probably come out 2010 or 2012.
Will sly4 have new characters?
of course!!! because if theres know new characters who is there to fight?
Trending Questions
Why is the veil a symbol of Hestia?
What are penguins strengths and weaknesses?
Can you sue if you are jailed you are convicted by a jury?
What is the driving distance from Billings Montana to Eureka California?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What actors and actresses appeared in Dirty Dancing - 1988?
Was President Kennedy's inaugural speech the most listened to?
What chocolate is known as fat from the north?
What is the next manga book in warrior cats series?
Where and when was the first McDonald's opened in France?
Why is it difficult to predict how much money someone In 2005 the median annual income of high school dropouts was about 6000 less than the median annual income of high school graduates. If the high?
What was the Puritan Republic?
What enzymes break down vitamin k?
What do the background singers say in Sophie B. Hawkins' song As I Lay Me Down?
Do lebanese citizens need a visa to visit oman?
How can I start a superworm colony?
What is the code for wizards of Waverly place to win props?
What are the four types of narrators?
What is a 5 letter word to remove hair?
What race invented the constellations?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.