answersLogoWhite

0

What is th population of carmarthen?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/17/2019

14,648

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

How big is carmarthen?

Carmarthen is a town in Wales, serving as the county town of Carmarthenshire. It has a population of approximately 14,000 residents. The town covers an area of about 3.5 square miles (9 square kilometers). Carmarthen is known for its historical significance and as a center for local commerce and culture.


County town which claims to be the oldest in wales?

carmarthen


When was Carmarthen Journal created?

Carmarthen Journal was created in 1810.


When did Carmarthen Ministry end?

Carmarthen Ministry ended in 1694.


When was Carmarthen Ministry created?

Carmarthen Ministry was created in 1690.


Where in Wales is carmarthen?

Carmarthen is in the south west of Wales actually in Carmarthenshire :)~


When was Carmarthen Athletic RFC created?

Carmarthen Athletic RFC was created in 1944.


When was Carmarthen Town A.F.C. created?

Carmarthen Town A.F.C. was created in 1948.


When was Carmarthen Quins RFC created?

Carmarthen Quins RFC was created in 1875.


When was Carmarthen railway station created?

Carmarthen railway station was created in 1902.


When was Carmarthen Amateur Operatic Society created?

Carmarthen Amateur Operatic Society was created in 1891.


What is the country code and area code of Carmarthen United Kingdom?

The country code and area code of Carmarthen, United Kingdom is 44, (0)1267.

Trending Questions
What is a Crackin? What is the mean of 2 6 9 7? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What are powers directly stated in the constitution called? What is the cpt code for deviated septum? What are the advantages and disadvantages of modern n traditional tools? Is shelter a problem in Uganda? What is the Hawaiian word for muffin? Was the Mexican War a defensive war or a war of aggression? How do you simplify fractions such as 2 over 6? Where is the pineal body found? What is the medical term for protrusion of the eye? Where can one find HSBC bank branches in the UK? Who are the people in the illiminati? How do you stop ruining the bottom of your shoes? How does the elevation affect the climate in mesoamerica? Where does the African leopard shelter? How long does it take a hyperscan from the us get to Spain? Who is the main star in the Rascal Flatts video? Where can you watch Sugar Sugar Rune episode 36 in English subtitles?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.