0
What else can I help you with?
Related Questions
What is the English translation of the Chinese word 'mushu'?
chinese translation of the word "education"
What is the Samoan translation for the word goodbye?
Tofa soifua
What is the Samoan translation of the English word goodbye?
Tofa soifua
How do you write goodbye in mandarin Chinese?
Zài jiàn - 再見/再见 - Goodbye
How do you phonetically say goodbye in Chinese?
The most common way to say goodbye in Chinese is 再見. In Hanyu Pinyin this is pronounced zai4jian4. In GR romanization it is pronounced tzay jiann. Another way of saying goodbye that may be easier is "拜拜" which is pronounced "bai1bai1"
What is the translation of the word 'heart' to Chinese?
'Heart' in Chinese is 'xin' or 心.
What is the Chinese translation for the word fungi?
a fungus
What is the translation for the word gorgeous in Chinese?
balls
Yiddish word for goodbye?
Shalom! that is goodbye in Yidish.
What is the Cajun translation for goodbye?
The Cajun translation for goodbye is "Adieu."
How do you pronounce goodbye in Chinese?
Zai jian Pronounced (Zii chen) The "ii" is supposed to be pronounced like in the word "lie"
How do you spell the Chinese word for goodbye?
pin yin: zai jian 再见
Trending Questions
How can I fix a toilet leaking from the pipe at the back?
Why is Sudan a Islamic country?
What is a real estate cash flow note?
Applications of a circular waveguides?
What is the area if the circumference is 40.8cm?
What does qing wen ni ma jia you jia you ji kou ren mean in Chinese?
What occurs when a muscle becomes smaller and weaker from not being used?
How many soldiers were sent to World War 1?
Why would someone need their legs amputated?
Pressure in terms of mm of water?
Where does Luke go directly after leaving Tatooine Star Wars?
What is the potential of a reference node in DC circuits?
How do you figure the answer to what percent of 40 is 4?
What is yoon eun hye's height?
What was john waynes horse in chism?
What is a parabola the graph of?
What is the area of a circle with a radios of 4?
When did Joseph Maull die?
Which of the following shows topical organization?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.