0
What else can I help you with?
Related Questions
3 gal equals how many fl oz?
That is 384 fl oz.
Math2 gal equals how many fl oz?
That is 256 fl oz.
12 gal equals how many fl oz?
That is 1,536 fl oz.
1 gal equals 100 fl oz?
No, it equals 128 fl oz.
2 gal equals fl oz?
That is 256 fl oz.
2 gal equals how many fl oz?
That is 256 fl oz.
2 gal equals how many fluid oz?
2 US gallons is 256 fl oz.
How many fl oz in 4 gal?
4 gal = 512 fl oz
How may fl oz equals 4 gal?
23
120 fl oz equals 0.9375 gal?
yes it is
How many fl oz in 2 gal?
That is 256 fl oz.
How many fl oz are in 1.5 a gal?
That is 192 fl oz.
Trending Questions
A murder that happened in reading Pennsylvania between 1985-1987 the guys who committed the crime name's where john and Michael?
What does the medical abbreviation TTWB mean?
Can you get eye cancer from staring at a computer monitor with sunglasses on?
What is a the difference between a variable and an observation?
Give two practical application of impulse-momentum theorem?
How To Make A Flame Thrower?
Is there a fuse for the temperature gage on the dash of a 1995 Honda Accord lx?
Do tawny owls sleep at night or during the day?
How old is Mistyfoot?
Are skateboard shoes good for parkour?
What is the red spot under Gerard Way's eye?
Can you get the flu shot while taking Flagyl?
What is the prize for finding all 39 clues?
What was the light bulb invented?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the definition of consul?
Countries of the world in ABC order?
How did portage la prairie Manitoba get its name?
Is Christian Dior Made in the US?
Contraception literally means against conception According to this definition is an intrauterine device a contraceptive?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.