AUG also the start codon for protein synthesis. The amino acid will be Methionine, may want to double check spelling of that
mRNA - aug,cau,gca,agu,uag
tRNA - uac,gua,cgu,uca,auc
Amino Acid Chain (in case you were wondering) -
Methionine , Histidine , Alanine , Serine , Stop
auucgcgcaauaaauuugggg
The tRNA has the anticodon and mRNA has the codon.
the anticodon is found on the tRNA molecule Sources: Pearson Biology book. By Miller and Levine
The mRNA codon and tRNA anticodon pair up on the ribosome.
An anticodon. -APEX Learning
A tRNA anticodon pairs with an mRNA codon during translation.
The anticodon would be CUA
Anticodon for Methionine (Met) is UAC.
A pairs with T so the anticodon would be TTT
tRNA contains the anticodon
The tRNA has the anticodon and mRNA has the codon.
Anticodon on the tRNA base- pair with the codon on the mRNA and catalyses the elongation of the polypeptide chain in translation. Besides that, anticodon are specific and the specific anticodon on the tRNA decides what types of amino acid it carries on the 3' end.
It can. If the codon has an "A," then its anticodon must have a "T."
On the tRNA it is called the anticodon.
anticodon.
The matching anticodon for GCA would be CGU.
someone please improve this answer i dont know what this is.
The anticodon is on one end of a tRNA molecule while an amino acid is on the other.