answersLogoWhite

0


Best Answer

AUG also the start codon for protein synthesis. The amino acid will be Methionine, may want to double check spelling of that

User Avatar

Wiki User

11y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

13y ago

mRNA - aug,cau,gca,agu,uag

tRNA - uac,gua,cgu,uca,auc

Amino Acid Chain (in case you were wondering) -

Methionine , Histidine , Alanine , Serine , Stop

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

auucgcgcaauaaauuugggg

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What is the anticodon for Auggcauacaaguucgacggagcaaauuuugguacuuuguaa?
Write your answer...
Submit
Still have questions?
magnify glass
imp