0
What else can I help you with?
Related Questions
How tall is Buddy Messinger?
Buddy Messinger is 5' 8".
What is the birth name of Gertrude Messinger?
Gertrude Messinger's birth name is Gertrude Emma Messenger.
When was Buddy Messinger born?
Buddy Messinger was born on October 26, 1907, in San Francisco, California, USA.
When did Buddy Messinger die?
Buddy Messinger died on October 25, 1965, in Los Angeles, California, USA.
What actors and actresses appeared in Buddy at the Bat - 1923?
The cast of Buddy at the Bat - 1923 includes: Buddy Messinger as Buddy
What is the birth name of Buddy Hart?
Buddy Hart's birth name is Nathaniel Buddy Hart.
What is the birth name of Buddy Knox?
Buddy Knox's birth name is Knox, Buddy Wayne.
What actors and actresses appeared in Bringing Up Buddy - 1923?
The cast of Bringing Up Buddy - 1923 includes: Buddy Messinger as Buddy
What is the birth name of Buddy Schwab?
Buddy Schwab's birth name is Eugene Schwab.
What is the birth name of Buddy Roberts?
Buddy Roberts's birth name is Dale Hey.
What is the birth name of Buddy Rogers?
Buddy Rogers's birth name is Herman Rohde.
What is the birth name of Buddy Napier?
Buddy Napier's birth name is Israel Napier.
Trending Questions
What was Martha Washingtons date of death day month and year specific?
When did dawn fraser start swimming?
What are the three objects that do not attract the magnets?
Which state contains a girl name?
Who makes silo TVs?
What should you do if none of the outlets in the upstairs bathrooms work and you checked the circuit breaker and clicked the reset button?
What is setteling a dispute by agreeing to accept the decision of a neutral outsider called?
What are posidens powers?
Located on the ribbon and is used to display the borders gallery?
Do women wear black or red thread on their waist?
What does min ya mean?
What is most likely to weight 5 kilograms sheet of paper book pencil or notebook?
Does fruit rott faster in a refrigerator?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Is pork in twizzlers candy?
Is goat a pet or domestic animal?
What word does m stand for in roman numerals?
Which element in the periodic table is a saucepan made of?
I am 5 foot and 11 inches I weigh 106 lbs but I think I may be fat Part is muscle because I swimexersize 7x a week and I am a serious equestrian. But I haven't really eaten for weeks. Am I too fat?
He works slowly but steadily which word is the verb?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.