answersLogoWhite

0

What is the birth name of Jun Osaka?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Jun Osaka's birth name is Yoshiji Watanabe.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is the birth name of Jun Fujio?

Jun Fujio's birth name is Fujio Jun.


What is the birth name of Chris Jun?

Chris Jun's birth name is Kyoung-Hoon Jun.


What is the birth name of Ed Jun Kim?

Ed Jun Kim's birth name is Jun Kim.


When was Jun Fujio born?

Jun Fujio was born on November 3, 1911, in Osaka City, Osaka, Japan.


What is the birth name of Jun Tatara?

Jun Tatara's birth name is Shigeji Tatarai.


What is the birth name of Jun Tazaki?

Jun Tazaki's birth name is Minoru Tanaka.


What is the birth name of Jun Mizuki?

Jun Mizuki's birth name is Noriko Fukuchi.


What is the birth name of Jun Mayuzumi?

Jun Mayuzumi's birth name is Junko Watanabe.


What is the birth name of Jun Aristorenas?

Jun Aristorenas's birth name is Juanito Aristorenas.


What is the birth name of Jun Hasumi?

Jun Hasumi's birth name is Shigetoshi Takahashi.


What is the birth name of Jun Henmi?

Jun Henmi's birth name is Mayumi Kadokawa.


What is the birth name of Jun Funato?

Jun Funato's birth name is Tsunetaka Iwai.

Trending Questions
What are the five highest mountains in the Appalachians and the altitudes? How do you save panda from extinction? What is hydrophilic moiety? What are tHe types of farming in Pakistan? What was the philosophy followed by William Graham Sumner? How can I confirm that a house does not contain any asbestos? How do you delete tap tap account on iPod touch? Is the Scotch Opening a good choice for players looking to gain an advantage in the opening phase of a chess game? Where can one purchase a secondhand Toyota Coaster? How cashe memory work? Can a cat transmit rabies to their kittens from nursing? Where is peridotite found in the Earth? When did man discover the sun moves along its celestial orbit? How do you set the timing on a 1991 Chevy Suburban R1500 5.7 V8 350ci T.B.I? How can ears help us walk tightropes? Where is the nearest cell phone shop? What is the relative formula mass of lead oxide? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? What is the curb weight of the 2006 BMW 3-Series? What statement about the 16PF is false?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.