0
What else can I help you with?
Related Questions
What is the loudest call monkey in the world?
the phone call monkey
Which Nokia has the loudest speaker?
The loudest will be the Nokia 6233.
What is the superlative for loud?
The superlative for "loud" is "loudest."
What was the loudest event?
The loudest event was 9/11.
A sentence using the word loudest?
We can shout the loudest! The loudest part of the audience at the stadium was the home team's section.
Who has the loudest fans in the NHL?
It is a fact that the Carolina Hurricanes are the loudest.
When was Loudest Whisper created?
Loudest Whisper was created in 1970.
What is the loudest car amplifier?
The Loudest TL-2093 Amp is the loudest amplifier with a 1500watt 2channel amp with omponent speakers or subwoofers.
Is the howler monky the loudest mammal?
The Howler monkey is the loudest mammal.
When was Loudest Love created?
Loudest Love was created in 1990-10.
What is loudest sled exhaust?
The Loudest Sled exhaust tip is the megaphone style.
When was The Loudest Engine created?
The Loudest Engine was created on 2011-09-09.
Trending Questions
Is 0.420 less than 0.42?
Can you record on iMac?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Why the need for redenomination in Ghana?
Is it illegal for a 17 year old girl to run away in California?
Where is the fuel pump relay on a 93' mercury topaz?
How much are 100mw laser pens?
How do you adjust governor screw to make peace sport 2012 scooter faster?
What is 15 percent of 3200?
What is made by combining monomer compounds into polymer molecules?
Which culture did the gunpowder the abacus and the compass?
What can adult stem cell turn into?
What are the chances of pregnancy on day twenty-two?
What is prime factor of 27?
What are Roman numarals?
Does the trombone use a mouth piece?
Is orange an earth tone color?
What has seven lines?
What is the name of the Telugu version written by veeresalingam regarding Gulliver's Travels?
How far can the longstrike shoot?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.