0
What is the molecular sequence which is the blueprint for a protein?
Wiki User
∙ 9y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What a molecular data?
In biology, molecular data refers to the information pertaining DNA or protein. DNA sequence are highly specific that encode the RNA and proteins. It is also specific signature for a particular kind of organism to define which family it is.
What organelle can be described as the blueprint to the creation of a protein?
The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.
What sequence best represents the relationship between DNA and the traits of an organism?
DNA base sequence amino acid sequence protein shape protein function trait
What is the term for one blueprint that tells a cell how to build a protein?
Jeebus-3
How is find the gene sequence of an monoclonal antibody found?
find the protein sequence in protein sequence data base.....then from the protein sequence u can find the antibody gene sequence...... u can also go for nucleotide sequencing....which will directly help u in getting the sequence.....u can check this in bioinformatics data base
What Reads the blueprint and brings and inserts correct amino acid in making a protein sequence?
tRNA (transfer ribose nucleic acid.)
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
What is molecular evidence or a DNA sequence?
what does molecular evidence mean
What a molecular data?
In biology, molecular data refers to the information pertaining DNA or protein. DNA sequence are highly specific that encode the RNA and proteins. It is also specific signature for a particular kind of organism to define which family it is.
Which type of RNA is called the blueprint for construction of a protein?
The answer is mRNA.
What organelle can be described as the blueprint to the creation of a protein?
The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.
What has the author Dongsheng Wang written?
Dongsheng Wang has written: 'Molecular cloning and nucleotide sequence of a Streptococcus mutans gene encoding biotin carboxyl carrier protein'
Which structure determines the sequence of the building blocks in a protein?
DNA determines the sequence of the amino acids (building blocks) in a protein. The sequence of nitrogen bases in the DNA determines the sequence of amino acids in a protein.
How can a mutation in a DNA base sequence cause a change in protein?
dna in a cell needs protein and chromosomes.
What sequence best represents the relationship between DNA and the traits of an organism?
DNA base sequence amino acid sequence protein shape protein function trait
Where are gene sequence for protein in a prion?
there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.
What determines the amino acid sequence in a protein?
The sequence of amino acids in a protein is determined by the sequence of nucleotides in the mRNA, and this is determined by the sequence of nucleotide bases in the DNA.
