answersLogoWhite

0

What is the motto of Streit's?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Streit's's motto is 'From our Family to Yours'.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

Is streits matzos bread leaven or unleaven?

unleaven


What is the motto of Swaziland?

Lesotho's motto is ''.


What is the motto of Walsingham School?

Walsingham School's motto is 'No Motto'.


What is the motto of Dainese?

The motto of Dainese is 'Inspired by humans.'.


What part of speech is motto in the sentence That motto is cool?

In the sentence "That motto is cool," the word "motto" is a noun. It is used as the subject of the sentence.


What is the motto of Puntland?

The motto of Puntland is 'Star of the North'.


What is Belmont Academy's motto?

Belmont Academy's motto is 'as the co-motto'.


What is Iceland motto?

Iceland has no official motto.


What is Sarnia's motto?

Guildford High School's motto is 'As One That Serveth'.


What is FIFA's motto?

The motto of FIFA is 'For the Game. For the World.'.


What is Texas is motto?

The State Motto of Texas is Friendship


What is the motto of Harobino Vidya Bhavan?

Harobino Vidya Bhavan's motto is 'Motto'.

Trending Questions
What happens to the angle of declination into the accounts when you are closer to the poles? How does cumin get spoilt? How many crew members were there in the Apollo missions? How do you tell your ex you dont like them anymore? What are some household kitchen items that do not use electrical energy? What are 3 reasons why Aristotle believe democracy was the best form of government? Where can one finds the best remortgage rates? What does you do if you crush cares about you and kida likes you as a friend but dont love you? What times what equals 5600? Is dawn Marie from WWE lesbian? Does a jacket produce heat if so what is the energy source? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What did cahuilla Indians used for clothing? What is the different between audio streaming and audio downloading? What does the phrase it is difficult to produce a clapping sound with one hand mean? When were kettles first used? What is difference between sulphides and sulphates? What is the important about the delta? Are human vampire's real? Was the Golden Dawn good or evil?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.