0
What else can I help you with?
Related Questions
What was the code name for Kinect?
Project Natal
What was the code name of Kinect?
Project natal
Will you have to buy an xbox 360 to buy project natal?
When Project Natal is released, yes, you will need an Xbox 360 to use Natal.
Is the Project Natal Real?
Yes project Natal is real. However it is now called Kinect
How much is Project Natal for XBOX 360?
Project Natal is now called the Kinect. The prices vary on what deals you would like.
What is better sony move or Microsoft project natal no biased answers please?
Natal.
Who invented project natal?
Microsoft. Alex kipman incubated the project.
Is Xbox natal an attachment to Xbox 360?
Yes, Project Natal is an add-on for the Xbox 360.
Will Project Natal be avalaible on ps3?
no, it has the move. project natal is for Xbox 360. and is now called Kinect, i should know i saw it announced live
How much does project natal cost?
1doller
When will project natal come out?
The project natal will come out Fall 2010 ONLY FOR THE XBOX 360. Around September 20th to the last day of November. yep.
Do you need a Xbox 360 if you get project natal?
Yes
Trending Questions
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What is the easiest gym move ever?
What is the population of the city of Liverpool?
What does Athens mean?
What are you going 2 do if your ex wants to go back out?
What 3d shape has 8 vertices?
Where can you buy dread lock gel?
What was inside the Celestic Shrine in Pokemon Platinum?
How many km from Moncton NB to Ottawa ON?
Explain the function of preset and clear input?
How did Askia the great support education in timbuktu?
How long of a drive in hours is it from Boston Massachusetts to Portland Maine?
Words ending with ough that sound like oh?
Can you cash a large check at your bank same day?
What happened at valkyrie?
Iwant to install toilet in your workshop do you have to vent the pipe?
What is the difference of work and joule?
How do you get super fan swag tokens in adventure quest worlds?
What objects can the wind move?
What two features are usually found near the entrances of temples?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.