0
What else can I help you with?
Related Questions
What is the history of anthrax?
what is the history on the anthrax disease
What is the pathpgen name for anthrax?
bacillus anthrax
When was The Anthrax created?
The Anthrax was created in 1982.
What is the chance of being cured with anthrax?
there are three form of infections with anthrax. Pulmonary anthrax that it is deadly if not treated early gastrointestinal anthrax fatality rates 20- 60% cutaneous form of anthrax that it is really fatal
What is the chemical composition of anthrax?
Anthrax cause is a bacteria.
What kind of microbe is Anthrax?
Anthrax is a form of bacteria
Can anthrax infected cow's milk transmitted anthrax to human body?
No. Anthrax bacteria is killed through the process of pasteurization. Milk would not be drunk either from a cow that has died of anthrax.
What disease does anthrax cause?
Strangely enough, it causes anthrax.
Is anthrax ontagious?
No, anthrax cannot spread from person to person.
When was Anthrax - band - created?
Anthrax - band - was created in 1981.
When was Church of Anthrax created?
Church of Anthrax was created in 1970.
Is Anthrax disease bacterial or viral?
there are variations of anthrax that are viral and bacterial most anthrax is bacterial
Trending Questions
What is the drive cycle for a 2002 mercury mountaineer?
What is the distance between SC and Hawaii?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What does it mean when your boyfriend says he has strong feelings for you?
How do you say he used to bother the fish in the aquarium in spanish?
Why do plants absorb carbon dioxide?
How can you get a cute boy to kiss you without asking?
When was Karma Cola created?
What are Stephenie meyers accomplishments?
How do you open a Keep Safe Diary when you've forgotten it?
What is a synonym for countershaded?
What is a typical setting in Gothic writing?
How educated is Nadia Buari?
Does one blue eye in golden retrievers represent blindness?
Are any countries famous for pottery?
What does agueros say turned the tunnels into mattresses In sonnet for heaven below?
Where Paleolithic people alive when dinosaurs where around?
What store have pocket bac anti-bacterial hand gel?
What is the behavior of a coral?
What is a synonym for esoteric?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.