0
What else can I help you with?
Related Questions
What is the population of Azganin-e Sofla?
The population of Azganin-e Sofla is approximately 1,500 people.
What is the population of Zardalu Sofla?
Zardalu Sofla's population is 14.
What is Khomeh Sofla's population?
Khomeh Sofla's population is 860.
What is Kond Sofla's population?
The population of Kond Sofla is 122.
What is the population of Sheyfan Sofla?
The population of Sheyfan Sofla is 59.
What is Mivaleh Sofla's population?
Mivaleh Sofla's population is 31.
What is Darreh Mahi Sofla's population?
The population of Darreh Mahi Sofla is 119.
What is Buin-e Sofla's population?
Buin-e Sofla's population is 1,069.
What is the population of Poshteh-ye Sofla?
The population of Poshteh-ye Sofla is 87.
What is Baghelah-ye Sofla's population?
Baghelah-ye Sofla's population is 220.
What is Dinarvand-e Sofla's population?
The population of Dinarvand-e Sofla is 409.
What is the population of Mazraeh-ye Sofla?
The population of Mazraeh-ye Sofla is 29.
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.