0
What else can I help you with?
Related Questions
What is the area of Kinh Mon District?
The area of Kinh Mon District is 163 square kilometers.
What is Mon district's population?
Mon district's population is 250,671.
What is the population of Na Mon District?
The population of Na Mon District is 35,234.
What is O Mon District's population?
The population of O Mon District is 128,075.
What is the population of Chbar Mon District?
Chbar Mon District's population is 41,478.
What is Mon State's population?
Mon State's population is 2,672,000.
What is the population of Mon Chong?
Mon Chong's population is 6,008.
What is Mon Pin's population?
Mon Pin's population is 19,123.
Does kinh thanh tan uoc means Catholic Bible?
Kinh Thanh Tan Uoc means the news testament on the Bible. There are two parts of the Bible: The old testament (kinh thanh cuu uoc) and the new testament (kinh thanh tan uoc). Kinh thanh tan uoc started with the bith of Jesus Christ. Kinh thanh cuu uoc means the bible before Jesus Christ.
What is Kiruhura District's population?
Rukungiri District's population is 327,100.
What is the population of Mbale District?
Kamwenge District's population is 363,200.
What is the population of Nong Mamong District?
The population of Nong Kung Si District is 65,521.
Trending Questions
What should you do to leave merry-go-round in order not to fall down?
What is the meaning of the laundry pin on a bikers jacket?
What is the chemical that blocks most of the ultraviolet light from reaching earth?
How many ATM of pnb in kolkata?
Im almost 15 and im 5'2 most of my friends are taller than me am i under the average do you think?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the last sense to leave the body when you die?
How did Girl Guides begin?
What was one of the archangels named in the Hebrew tradition?
Why is RNA needed in a cell?
Where did endless shoes come from?
Why did the US intervene in the Mexican Revolution?
How much did Turtle win in the Westing Game?
Why did New Zealand john walker become a athlete?
How willu obtain butan-2-ol from propanal?
How do you get on top of Hideki tower on Skate 2 for Xbox 360?
When did Samuel Tertius Galton die?
Where can you buy vernors in Michigan?
What is the largest nuclear charge of group 2?
Does Connecticut have a football team?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.