answersLogoWhite

0

What is the third book for Skeleton Creek?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

Well, the third book is called : THE CROSS BONES

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

What is the name of the third Skeleton Creek book?

The third Skeleton Creek book is called "The Crossbones."


What is the third book in Skeleton Creek called?

Skeleton Creek The Crossbones. But I think there's going to be a forth book of skeleton creek


When will the third Skeleton Creek book be out?

it is out


Is there going to be a third Skeleton Creek book?

probably


What is the name of the third book in the Skeleton Creek series?

Crossbones


Is there going to be a third book of Skeleton Creek?

Yes! It came out in february 2011


What is the new Skeleton Creek BOOK called?

yes the roomers are true the third book will be called THE CROSSBONES.


What are Skeleton Creek passwords for book 2?

skeleton creek passwords for book 2


Is there a fifth book to the Skeleton Creek series?

There are four books in the Skeleton Creek book series.


What are the Skeleton Creek passwords for book 2?

skeleton creek passwords for book 2


Is Skeleton Creek a series?

skeleton Creek is a book series, and a good one in my opinion.


What is skeleton creek?

Skeleton creek is the first book in a scary seriesw by Patrick Carman! skeleton creek is also oner of the best books ever!

Trending Questions
What do you call the separate grain from straw? How much gunpowder did Guy Falks use? Does Selena Gomez live with her step brother and step sister? When was Aimé Haegeman born? What is the average stair rise measurement in residential buildings? Why does the optic nerve cause the blind spot? How does anorexia and bulimia affect Guatemala? Is buddy used for both boy and girl? Why does your ford E350 van destroy serpentine belts? What are the slang words benefits? I was a jazz pianist and composer who often played at Harlem's cotton club? What is the mRNA strand for ggctatatcctgcgctatacgcta? How many centuries equal a Millennium? Discuss the importance of marketing research for non profit organization? How long is the flight from Tokyo to cebu? 1 over 4 divided by 1 over 6? How do you do algebra 1-unit 5 test? What is the term for a genetic condition where both alleles for a particular trait are different from each other? Which conquistadores helped destroy the Inca? What was the name taken by 13 popes?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.