answersLogoWhite

0

What is usher son name?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/17/2019

Ushers Children Are Named Usher Raymond V and Naviyd Ely Raymond

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Does Chili have a son by Usher?

No, her son is by producer Dallas Austin not Usher


How old is Usher's son Dash?

Usher doesn't have a son named Dash


Is usher having a nother son?

Usher as two sons: Usher V and Naviyd


Who is usher kids?

Usher's 1st son, Usher Terry Raymond V, was born November 26, 2007. His 2nd son, Naviyd Ely Raymond, was born December 10, 2008.


What is usher's name?

Usher's full name is Usher Terry Raymond IV


Is Justin Bieber a son of Usher?

no


Is Jacob latimore usher's son?

No...


Is 'Usher' Usher's first or last name?

Usher full name is Usher Terry Raymond IV


Does Usher have a son?

Usher has two sons.


Is Justin Bieber usher's son?

NO! Usher is the one who signed Justin to his record label.


Did usher have a baby with chilli?

Yes i think usher had a baby from chili because iseen chili son off;of what chili wants and her son looks just like usher 4 real.


Whats usher's real name?

His name is Usher Raymond IV.

Trending Questions
How can I spend more time with horses if I dont have my own? What is b squared to 100? Who settled the colony of caralina? What answer did shadrack make to the unasked question? What is the names of all jls members? Sharp atomic clock SPC373 can not get your outside temp to set? What is the origin of wig? What steps did Lincoln take to preserve the union before and after the fighting at fort Sumter? What are the best techniques for applying whitewash paint to brick surfaces? 96 mercury mystique fuse configuration? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do crafts help in school? What do the bells do in the plaza in Kirby's epic yarn? What did the Byzantine empire do to control the Roman Empire? Can a pastor have someone committed? What are some famous people that begin with the letter z? What is controllable and uncontrollable cost? Where can you have an outdoor outing in Rhode Island? Where is the Oxygen sensor on a 1997 4runner? What movies has Anna popplewell starred in?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.