0
What else can I help you with?
Related Questions
What kind of scientist studies animals and their classifications?
Zoologists study animals.
What kind of scientist goes to exotic areas to study and discover new species of plants and animals?
An extremely lucky scientist.
What type scientist study animals?
zoologists
What type of scientist studies animals?
zoologistZoologist are scientist that study animals
Are animals good for scientific study?
Yes scientist tend to study animals to see what they can or can't do, they're very useful to scientist as they can provide them with a lot of new information.
What is the name of the animals that the scientist study?
zooligest,vet
What kind of scientist study's humans?
a geneticist
What kind of scientist study organisms?
Biologists.
What kind of scientist is a pathologist?
They study diseases.
What kind of scientist study paralysis?
Neurologists study the nervous system.
What kind of natural phenomenon do scientists study?
It depends on what kind of scientist it is. For example, botanists study plants.
What scientist study history of plants and animals?
. biologist./ Palaeontologists
Trending Questions
How bad is it to do a foreclosure and a bankruptcy at the same time?
What is Plotinus' perspective on beauty and how does it differ from other philosophical views?
Is 8 pints and one cup bigger than 2 gallons?
What do payroll clerks get paid?
Why white discharge after taking primolut nor?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What does it mean that an Iceberg has calved?
Should you use 10w 30 or 5w30 oil in a 95 Ford F 150 with the inline 6 cylinder?
RDY and NDA are?
What is .5 percent of a million dollars?
How does one go to the Half Dome?
Where is team magma in soul silver?
How do you report telemarketing calls to your do-not-call cell phone?
Is splenda and popcorn good for you?
Does an eagle eat a wolf?
What is the surface area and volume when the width is 9 cm and the height is 14 cm and the depth is 7 cm?
What is the meaning of paragraph by analogy?
Why is hair not digestible?
How do you say its a pleasure in Spanish?
How can I improve my technique in playing guitar barre chord shapes?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.