0
What else can I help you with?
Related Questions
What level does totodile evolve on Pokemon soul silver?
Level 18.
What level does cyndaquil evolve at in soul silver?
Cyndaquil and Chikorita will evolve at level 16. But totodile evoles at a level 18. :-) - :-) Hhopkins1108 :-)
What level do the 3 starter Pokemon evolve at on soul silver?
cyndaquil evolves at level 14 and 36 totodile evovles at level 18 and 30 chikorita evolves at level 16 and 32
What level does totodile on soul silver?
lv 18 to crocnaw and lv 30 to feraligatr
What level does pidegy evolve-soul silver?
Level 18.
What level do lavitar evolve in soul silver?
Level 30.
What level does meowth evolve in the soul silver?
Level 30.
What level does crabby evolve in the soul silver?
level 28
What level does polywag evolve on soul silver?
Level 25
What level does a swablu evolve in soul silver?
Level 37.
What level does gastly evolve at in soul silver?
Level 26
What level does scorupi has to be to evolve in soul silver?
at level 40 it should evolve into drapion
Trending Questions
How much do drinking fountains cost?
Does SpongeBob like squidward?
How can you get your repossessed boat back?
Can cattle mineral hurt a horse?
Which method of organization organizes your essay according to time?
How many horns can a chameleon have?
Make one bird name which start with urdu word WAO?
Where can you get a good tf2 furry spray?
Is there any grants from the government when arson occurs?
How much does it cost for a new jeep canvas?
Why did vinegar and salt solution clean the pennies?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What was Sir Isaac Newton weakness?
Dixie are below the Mason-Dixie line?
Competence used in a sentence?
How do you fix a window that will not stay up on a 2002 Jeep Grand Cherokee?
Is Iraq located in the middle east of Asia?
In-line vs external image?
What is the English translation for abajo una hay calle?
What are forms of cell regulation?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.