answersLogoWhite

0

What nicknames does Larry Zience go by?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Larry Zience goes by Z.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

What nicknames does Larry Sandez go by?

Larry Sandez goes by Larry.


What nicknames does Larry Wallison go by?

Larry Wallison goes by Larry.


What nicknames does Larry McReynolds go by?

Larry McReynolds goes by Larry Mac.


What nicknames does Larry Wessel go by?

Larry Wessel goes by Father Larry.


What nicknames does Larry Spagnola go by?

Larry Spagnola goes by Spags.


What nicknames does Larry Shenk go by?

Larry Shenk goes by The Baron.


What nicknames does Larry Triplett go by?

Larry Triplett goes by Trip.


What nicknames does Larry Adlon go by?

Larry Adlon goes by Laer.


What nicknames does Larry Cureton go by?

Larry Cureton goes by Thunderfoot.


What nicknames does Larry Duke go by?

Larry Duke goes by Sundance.


What nicknames does Larry Copeland go by?

Larry Copeland goes by Lightnin'.


What nicknames does Larry McCarren go by?

Larry McCarren goes by Lamb.

Trending Questions
What is a Crackin? What is the mean of 2 6 9 7? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What are powers directly stated in the constitution called? What is the cpt code for deviated septum? What are the advantages and disadvantages of modern n traditional tools? Is shelter a problem in Uganda? What is the Hawaiian word for muffin? Was the Mexican War a defensive war or a war of aggression? How do you simplify fractions such as 2 over 6? Where is the pineal body found? What is the medical term for protrusion of the eye? Where can one find HSBC bank branches in the UK? Who are the people in the illiminati? How do you stop ruining the bottom of your shoes? How does the elevation affect the climate in mesoamerica? Where does the African leopard shelter? How long does it take a hyperscan from the us get to Spain? Who is the main star in the Rascal Flatts video? Where can you watch Sugar Sugar Rune episode 36 in English subtitles?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.