0
What else can I help you with?
Related Questions
What part of speech is the word moments?
The part of speech for this particular word is a noun.
What part of speech is the word my-?
The part of speech that the word my is used as is an adjective.
What part of speech is H?
H is a letter, not a word. To be a part of speech, it needs to be a word.
What is the part of speech for the entry word boulevard?
The part of speech for the word "boulevard" is a noun.
What is the part of speech for the word civilian?
The part of speech for the word civilian is English grammar.
What part of speech is speech?
The word speech is a noun.
What part of speech is stroobly?
It is not ANY part of speech, there is no such English word as "stroobly".
What is the part of speech of momentous?
The part of speech for this particular word is a noun.
What part of speech is ''is''?
The word speech is a noun.
What part is speech is is?
The word speech is a noun.
What part of speech is (THE)?
The word speech is a noun.
What "part of speech" is the word "two" in the sentence, "A man had two sons"?
What "part of speech" is the word "said?"
Trending Questions
What was unusual about the emperor's new clothes?
How do you change tail light assembly Toyota Echo?
How many decibels of sound will kill you?
How do you know a object's speed and velocity?
What do Nicki Minaj worship?
Who invented Ouran?
What day of the week was July 4 1997?
What episode of you Love Lucy did the living room window appear in?
What was the significance of Robert E. Lee in the Civil War?
What is a range of data that includes all numbers called?
How much are a pair of Nikon 7x21 6.7 Sprint III worth?
What biome is permaforst?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Are there practicing Jehovahs witnesses in Cuba?
How many years are creation and the flood apart?
Were high tariffs part of the Isolationism in the US?
What level does magneton learn zap cannon?
Who was on the Boston tea party?
How do you remould a gum shield?
Chlamydomonas is more like a plant cell than an animal why?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.