answersLogoWhite

0

What prefix is for able?

User Avatar

Anonymous

∙ 8y ago
Updated: 10/2/2021

un-

unable

dis -

disable

User Avatar

Kieran Crist ∙

Lvl 10
∙ 4y ago
Copy

What else can I help you with?

Related Questions

What is the prefix of able?

The prefix of "able" is "un-".


What is the prefixes and suffixes of inhospitable?

In- is the prefix. -Able is the suffix of inhospitable.


Where is the Prefix and the suffix of unpalatable?

The prefix of the word is un-. The suffix of the word is -able.


What is the prefix of flammable?

If you are talking about suffix it is -able ,but I don't know about prefix.


What is the prefix For portable?

'Portable' has no prefix. I has a suffix, though '-able'.


What is a Prefix and suffix for comfort?

Prefix: dis- Suffix: -able


Is incapable a prefix or root word?

The Latin root of the word incapable is capabilis from capere (to take). This provides the root -cap- and the suffix -able (suited for). The prefix in- usually means "not".Prefix, root, and suffix are in-cap-able(not suited for, i.e. not capable of doing something)


What is prefix for valuable?

-able


What is a prefix of able?

unable


What is the prefix operative?

Oper is the prefix. There is no suffix. Able is the root word.


What is the word's prefix?

Oper is the prefix. There is no suffix. Able is the root word.


In the word incapable what are the root suffix and prefix?

In prefix able suffix

Trending Questions
What is the molality of a solution made by dissolving 2 moles of NaOH in 6kg of water? Why does joy make suds? Why manuel v pangilinan still single? What is the cost of becoming a teacher? What is the plural form for words ending in ey? What shape has exactly 2 perpendicular sides? Who passes unemployment extensions? What tragedy happened in space exploration in 1986? How do i compare Britain and the 13 colonies in the mid-1700s? Why did slavery end answers for kids? What is the value of an HS .22 cal hand gun? What is the mRNA strand for ggctatatcctgcgctatacgcta? Who is the Cheerleader in nada surf's popular video? How do I lose 2lbs a day on a 1200 calorie diet I'm a 20 year old female weight 258 also how much protein and carbs should I have everyday? Why does George have a toothbrush sticking out of his ear in harry Potter? What are some good ideas for tonight at home? What do you call a fear of curtains? In what song is the line Even Rock Hudson lost his heart to Doris Day? What is the name of polygon with 1000 sides? How long does radiation stay in the body after treatment?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.