0
What else can I help you with?
Related Questions
What type of protists causes disease?
it is called malaria
What are some dangerous protists?
malaria
What group of protists cause malaria?
Plasmodia
What kinds of protists can cause malaria?
Mold
Is malaria a physical disease?
Malaria is a disease that is physically present in the body in the form of protists, a type of microorganism.
What is malarai?
Malaria is a infectious disease of humans caused by eukaryotic protists of the genus Plasmodium.see more about malaria CDC information at: cdc.gov/malaria/
Which cause malaria sleeping sickness and amoebic dysentery?
Protists
Which cause malaria African sleeping and amoebic dysentery?
Protists
What group of protists cause malaria toxoplasmosis?
malaria and toxoplasmosis are caused by protozoa of the genus Plasmodium and Toxoplasma, respectively.
What is the most widespread disease that protists cause among humans?
Malaria
What phylum of Protists causes malaria and toxoplasmosis?
Apicomplexan which known as phylum Sporozoan.
What diseases cause by animal like protists?
malaria and african sleeping sickness
Trending Questions
How do you test 4 wire PT100 temperature sensor RDT?
How many amendments in South Carolina's constitution?
What are the three most important gods in Hinduism?
How long is the flight from Melbourne Australia to the Caribbean?
What is 4.28 to the nearest tenths?
Can you drink energy drinks with lisinopril?
How much should i charge to paint a mailbox?
How are hydrographs useful to hydrologists?
Once a sedative and cure for nervous tension the ion of this element is now a trite or commonplace expression?
how can i make 10 using nine 9s?
What is Honduras coin?
What is the difference between Romanticism and Naturalism?
What time of year did the thylacine breed?
What is the balanced chemical equation of HCl and C6H8O7 Citric Acid?
Where is the heater control valve located on your 1994 e 150 van?
What is the meaning of 'virsa' in Punjabi language?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Where does Ariana Grande get her purple giraffe?
What is the classification of a triangle with sides of length 5 inches 12 inches and 13 inches?
What is the subscript of sodium chloride?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.