answersLogoWhite

0

What rhymes with Compton?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

On rims, on tims (the shoe)

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

Where is the Compton Library in Compton located?

The address of the Compton Library is: 240 West Compton Blvd., Compton, 90220 3109


Where is compton?

Compton is in surry


Where is the city of compton located?

There is a Compton in Arkansas There is a Little Compton, Rhode Island There is a Compton Parish in the UK (Compton and Shawford) There is a Compton in California with a bad reputation


What is the birth name of Compton Bennett?

Compton Bennett's birth name is Compton-Bennett, Robert.


What is the birth name of Betty Compton?

Betty Compton's birth name is Violet Halling Compton.


What is the birth name of Malaak Compton?

Malaak Compton's birth name is Malaak D. Compton.


What is the birth name of Compton MacKenzie?

Compton MacKenzie's birth name is Compton Mackenzie, Edward Montague.


What is the birth name of Cassandra Compton?

Cassandra Compton's birth name is Cassandra Louise Edith Compton.


What is the birth name of Denis Compton?

Denis Compton's birth name is Denis Charles Scott Compton.


When was Ann Compton born?

Ann Compton was born on January 19, 1947.


What was Scout Taylor-Compton's real first name?

Scout Taylor Compton was born as Desariee Starr Compton.


What is the birth name of Fay Compton?

Fay Compton's birth name is Virginia Lilian Emmeline Mackenzie Compton.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.