0
What else can I help you with?
Related Questions
What was the name of sacajawea's tribe?
Sacajawea tribe was called the ShoshoneShoshone
What tribe was sakajawea in?
please tell me what tribe Sacajawea from
What was Sacajawea's tribe?
shoshone
Was Sacagawea's tribe rich or poor?
Sacajawea's birth tribe Shoshone were rich until Sacajawea was under the age of 10 The Hidasta tribe stole ALL of their crops, horses and many Shoshone's. Including Sacajawea
Did Sacajawea ever come back to her tribe and if she did how did she get back to her tribe?
no
Where did Sacajawea's tribe lived?
Idaho
How did the Shoshone tribes?
that is not Sacajawea tribe
Did Sacajawea translate for her tribe?
yes she did
With which tribe was Sacajawea living when she joined the Lewis and Clark expedition?
Sacajawea was living with the Shoshone tribe when she joined the Lewis and Clark expedition.
Was Sacajawea a shoshone Indian?
No, Sacajawea was Native American. She was born into the Shoshone tribe.
What tribe was Sacajawea originally from?
e chechonry
What is the childhood of Sacajawea?
sacajawea was a part of the shoshone tribe untill she was kidnapped and then later on sold to charbonneau.
Trending Questions
What is 00.5 kg in milligrams?
How much would that person weigh on Mars?
What topics should not be discussed in polite conversation?
What is the strumming pattern for the chorus in the song disco by metro station?
What is the nutrient content of white chili?
Why do abs lights on Toyota 4 runner stay on?
When was Antonio Valverde y Cosío born?
What is a metaphor using the word tiptoe?
Does robin Padilla have 3 wives?
How can you maintain your Mitsubishi lancer es?
What is the difference between the number of frogs in the pond when the rainfall was 5 cm and when the rainfall was 20 cm?
Is lose a noun?
What is produced by white blood cells to identify and neutralise pathogens?
Where is the cc marking on a 1889 silver dollar?
Does tablets or capsules dissolves first?
Is running or walking healthier?
What is the measure of one of the exterior angles of regular pentagon?
How many minutes are in 2 thirds of an hour on a diagram?
What was the spacecraft the took neil Armstrong to the moon?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.