0
What else can I help you with?
Related Questions
What was Taylor Swifts's first job?
Taylor basically never had a job. she went to school and when she was 11 the music industry told her that they wanted to take her in, then when she was 12, they took her in and trained her. so she never really had a job
What Taylor swifts next album called?
Great job you
What job does Taylor swifts mom do?
Her mom quit her job when Taylor and her brother were born to take care of them. She used to be a home maker.
Who was Taylor swifts first crush?
Cory Anderson
Were was Taylor swifts first performance?
at the courty club
What was t swifts first boyfriends name?
marcoss
What was Taylor swifts first major hobby?
tennis
When was Jonathan Swifts first publication year?
2009
What is Taylor swifts job?
To sing and write songs due but she used to do some thing else
What was tylor swifts first hit in the UK?
Love story
What was Taylor swifts first song aired?
Tim mcgraw
What is Taylor swifts brothers first name?
Austin Swift
Trending Questions
Roosevelts New Nationalism program primarily hoped to?
Two numbers have a sum of 31 and a product of 228 What are the numbers?
What Native American group that lived in the American southwest also known for cliff dwellings?
Who were the green police of Holocaust?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does it means when a boy says there were taking a cold shower?
How do you get the clear bell in Pokemon liquid crystal?
Who got ball first in the Super Bowl this year?
What is the trigonometric values 82 degrees and 12 minutes using 3 major functions?
What should one do during a lion attack?
What is 42 over 441 in simplest form?
What percent of people in their late teens and early twenties have credit cards?
What does an egg represent when given as a gift?
What is a plutino?
When was Dónal Clifford born?
How did the northerners and Southerns view the secession of the south States?
What is Freeze Screen Saver exe Is it good or bad. Should I remove it from PC?
What happens when a relay is operated beyond its rated voltage or current?
What does tu es amusant mean?
What is the motto of Tintern Schools?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.