0
The Production Budget for Boys Don't Cry was $2,000,000.
What else can I help you with?
Related Questions
What was the Production Budget for Boys Don't Cry?
The Production Budget for Children of Men was $76,000,000.
Can boys cry?
Boys can cry
What was the Production Budget for The Cry of the Owl?
The Production Budget for The Cry of the Owl was $11,500,000.
What was the Production Budget for Cry Wolf?
The Production Budget for Cry Wolf was $1,000,000.
What is Nick's cell phone ringer on Nick and Norah's Infinite Playlist?
Nicks ringtone is "BOYS DONT CRY" by THE CURE
When was Boys Do Cry created?
Boys Do Cry was created on 2007-04-29.
When was Boys Don't Cry?
Boys Don't Cry was released on 10/08/1999.
When was Boys Don't Cry - album - created?
Boys Don't Cry - album - was created in 1978.
When was Boys Don't Cry released?
Boys Don't Cry was released on 10/08/1999.
Was the movie boys don't cry based on a true story?
Yes, it was based on a true story. Some parts are exaggerated but apart from that it is a true story.
What was the budget for Boys and Girls?
The Production Budget for Boys and Girls was $16,000,000.
What was the Production Budget for Jersey Boys?
The Production Budget for Jersey Boys was $40,000,000.
Trending Questions
What are the five highest mountains in the Appalachians and the altitudes?
How do you save panda from extinction?
What is hydrophilic moiety?
What are tHe types of farming in Pakistan?
What was the philosophy followed by William Graham Sumner?
How can I confirm that a house does not contain any asbestos?
How do you delete tap tap account on iPod touch?
Is the Scotch Opening a good choice for players looking to gain an advantage in the opening phase of a chess game?
Where can one purchase a secondhand Toyota Coaster?
How cashe memory work?
Can a cat transmit rabies to their kittens from nursing?
Where is peridotite found in the Earth?
When did man discover the sun moves along its celestial orbit?
How do you set the timing on a 1991 Chevy Suburban R1500 5.7 V8 350ci T.B.I?
How can ears help us walk tightropes?
Where is the nearest cell phone shop?
What is the relative formula mass of lead oxide?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the curb weight of the 2006 BMW 3-Series?
What statement about the 16PF is false?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.