0
What else can I help you with?
Related Questions
Popullation of Nepal?
28 million
Where are the areas with the lowest popullation?
Desert
What is popullation city parbhani?
450000
What country has the largest popullation?
China
What was the tigers popullation before?
there was about 100,000
When was Communities Scotland created?
Communities Scotland was created in 2001.
When was Live in Scotland created?
Live in Scotland was created in 2001.
When was Chess Scotland created?
Chess Scotland was created in 2001.
What is the popullation of amman?
about 1.3 million....
How many people live in ipswich?
According to the 2001 census, Ipswich has a popullation of about 117 000.
What is the population of Vancouver as of 2008?
the answer to what is the popullation in Vancouver in 2010 is 1,00,00,00,00
When was Office of the Public Guardian - Scotland - created?
Office of the Public Guardian - Scotland - was created in 2001.
Trending Questions
What car does Pele drive?
A name for IT fest having a good theme?
What are the parts of the marketing plan?
What is food products order?
What is the Answer Puzzle 134 in Professor Layton and Pandora's Box?
How many children does bobby jindal have?
Where is the boot release on a fiat 500 pop?
Why was Abraham important to Jesus?
What is auto-obtain ip address?
What is the large amount of solute?
What are the cast of victorious doing now?
What are some tips for playing Latin piano chords effectively?
Typically there is a predictable pattern in the selection of victims in an active shooter incident.?
In the report that Maconochie sent back to Britain about the penal colony in Tasmania What two key points were in the report that Maconochie sent back to Britain about the penal colony in Tasmania?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the 1968 Jefferson nickel with both sides heads worth?
Who is the only other person to win Oscars for acting and producing apart from George Clooney?
What is the average price for Ralph Lauren bedding?
Where in grocery store do you find solid coconut oil?
What is performance mode in Guitar Hero?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.