answersLogoWhite

0

What year discovered?

User Avatar

Anonymous

∙ 13y ago
Updated: 4/25/2023

Around the 1970's when Hip-Hop had first taken its roots. It wouldn't sound like Hip-Hop in the 80's and 90's, but it was more towards the sound of Poetry which was the base of Hip-Hop.

User Avatar

Kyla Klocko ∙

Lvl 13
∙ 2y ago
Copy

What else can I help you with?

Related Questions

Who discovered Florida and what year was it discovered?

mickey mouse year:1995


What year was the element yttrium discovered?

yttrium was discovered in the year 1794.


What year was ADHD discovered?

In the year 1902. Dr. Still discovered ADHD.


What year was nutmeg discovered?

it was discovered 1347


What year was the atomic number discovered?

ATOMIC NUMBER YEAR IN WHICH IT WAS DISCOVERED? it was discovered in 1913 by British physicist Henry Mosely


In what year was Argon discovered?

argon was discovered by Dr.william Ramsay of Scotland in the year 1894.


What year was sulfur discovered?

sulfur was discovered in 1777


What year was aluminum discovered in?

1825 aluminum was discovered.


What year was the Doppler effect discovered?

discovered in 1842


When was pnuemonia discovered?

this has been discovered in the year of 1941


What year was oil discovered in?

Oil was discovered in 1667


What year did boron get discovered?

Boron was discovered in 1808.

Trending Questions
What is the volume of a rectangular prism with a lenght of 10cm a width of 7cm and a height of 5cm? Who played Seth Bullock on Deadwood? What is Jenny Craig's phone number? What do you think the reason is? What is the percentage of freshwater is groundwater? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? How does the order of characteristics on a branching tree diagram help demonstrate evolutionary history? What were the Banana Wars? If a person files for divorce in North Carolina and cannot serve the other spouse with the divorce papers what would be the status of the divorce? What is 6 over 39? Can your boyfriend get in love about licking him? Who appointed Gerald ford as vice president? Where do they sell cachetadas candy in Houston? What are the features and benefits of the keychain viewfinder? Are you a child of a god or goddess? Are there any male singers whose musical type is Like Amy winehouse or duffy or joss stone? What is size of Alberta Canada? Why were conspirators against Caesar? Change a starter on 99 Acura TL? Bakit sinasabing nag-simula ang pabula kay Aesop?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.