answersLogoWhite

0

What you would find in a gene?

User Avatar

Anonymous

15y ago
Updated: 8/18/2019

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).

Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

Where can one find more information about gene dolls?

One can find more information about the Gene Marshall collectible fashion dolls on Wikipedia, or in the books 'Gene Marshall, Girl Star' and 'Gene' by Carolyn Cook.


Benefits of medical treatments that control gene expression?

I would guess that if a gene is not functioning normally then controlling the expression of that gene would be beneficial.


What surprises gene about his fight with with quackenbush?

Gene would not have expected to be Finny's defender.


How do you find a dragon gene?

You do not because there are no dragons


Why is a son who receives the allele for combinations from his mother always colorblind?

Since the mother would be considered a carrier, the gene will be produced in the offspring. the son will receive that gene and will be colorblind.


What is bengali language gene number?

This answer will be available with Language Research by Microbiology Genesystem . FOXP2 is a Gene of Language. Please ask the Specialist in Gene research to find the Gene Number of Bengai language.


Given a chunk of DNA sequences how do you find out if it contains a gene?

In order to find a gene jsut look for a start codon near a promoter and then look for a stop codon in the sequence everything between the start and the stop codon is a gene


Could males be a carrier of a specific gene and not show traits?

Yes. It is possible for a male to carry a gene and not show it. However, it would have to be a recessive gene, therefore the trait would not show physically. Though, if it is a sex-linked gene, they would either show the trait or not. They cannot be carriers and not show it.


A male with a missing SRY gene would be phenotypically?

A male with a missing SRY gene would typically have a female phenotype because the SRY gene on the Y chromosome is responsible for initiating male development. Without the SRY gene, the individual would develop along the female pathway.


How would RNA polymerase be affected if the repressor protein were not bound to the proper site on a gene?

If the repressor protein is not bound to the proper site on a gene, it would not block the RNA polymerase from transcribing the gene. This would lead to the expression of the gene, as the RNA polymerase can then proceed with transcription.


A scientist is trying to find a method to artificially produce a protein that is found in a pig's kidney What would be the first step of this process?

Find all mRNA produced by the kidney


What is gene therapy Explain?

If a person is lacking a gene that causes a disorder, for example Diabetes, and a gene can be inserted into cells that require the gene, this would be gene therapy. Parkinson's disease and X-linked SCID are two that are be researched.