0
What else can I help you with?
Related Questions
When was Al Goodman born?
Al Goodman was born in 1890.
When did Bertram Goodman die?
Bertram Goodman died in 1988.
When did William Goodman die?
William Goodman died in 1949.
When did Nelson Goodman die?
Nelson Goodman died in 1998.
When did Julia Goodman die?
Julia Goodman died in 1906.
When did Morse Goodman die?
Morse Goodman died in 1993.
When did Morris Goodman die?
Morris Goodman died in 2010.
When did Clifford Goodman die?
Clifford Goodman died in 1911.
When did Percy Goodman die?
Percy Goodman died in 1935.
When did Glenn Goodman die?
Glenn Goodman died in 1992.
When did Gerald Goodman die?
Gerald Goodman died in 1921.
When did Victor Goodman die?
Victor Goodman died in 1967.
Trending Questions
Where is the Ferrari car manufactured?
Why are my lifters tapping after flood water was drained from the engine and the oil has been changed?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Did Alexander Fleming do bad?
What is the meaning of game over?
What is 390.98 rounded to the nearest square meter?
What are intercalated disks?
Why do you think graphs are a useful way to display information?
Who is lyasan utyasheva?
What objects in outer space can hit earth and cause major damage to earth?
Why do Tamils wear dhotis?
How much is yu gi oh card number 39 utopia worth?
How much should you feed your 30 lb dog?
How much does an aircooled vw engine weigh?
What are organisation management and technology dimensions of information systems?
How many miles from Houston TX to Franklin TN?
What is the correct spelling for Best friend?
What is weight of pressure treated 12 x 12 piling?
Why are my tomato plant leaves drooping and curling?
What is the process that produces starch from the leaves?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.