0
What else can I help you with?
Related Questions
When was Anita Rothe born?
Anita Rothe was born in c. 1866, in Alexandria, Virginia, USA.
When did Richard Rothe die?
Richard Rothe died in 1867.
When did Hermann Rothe die?
Hermann Rothe died in 1923.
When did David Rothe die?
David Rothe died in 1650.
When did Carl Adolph Rothe die?
Carl Adolph Rothe died in 1834.
When did Johann Christoph Rothe die?
Johann Christoph Rothe died in 1700.
When did Heinrich August Rothe die?
Heinrich August Rothe died in 1842.
When did Bendt Rothe die?
Bendt Rothe died on December 31, 1989, in Denmark of heart seizure.
When did Edward Rothe die?
Edward Rothe died on December 10, 1978, in Bensberg, Bergisch Gladbach, North Rhine-Westphalia, Germany.
What is the birth name of Paulina Rothe?
Paulina Rothe's birth name is Paulina Rose Rothe.
What is the birth name of Sophie Rothe?
Sophie Rothe's birth name is Sophie Marie Rothe.
What is the birth name of Bendt Rothe?
Bendt Rothe's birth name is Bendt Vincentz Christian Rothe.
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.