0
What else can I help you with?
Related Questions
When was Charles Baudouin born?
Charles Baudouin was born in 1893.
When did Paul Baudouin die?
Paul Baudouin died in 1964.
When did Gervais Baudouin die?
Gervais Baudouin died in 1700.
When did Michel Baudouin die?
Michel Baudouin died in 1768.
When did François Baudouin die?
François Baudouin died in 1573.
When did Pierre-Antoine Baudouin die?
Pierre-Antoine Baudouin died in 1769.
When did Manuel Achille Baudouin die?
Manuel Achille Baudouin died in 1917.
When did Baudouin of Belgium die?
Baudouin of Belgium died on 1993-07-31.
When did King Baudouin die?
King Baudouin died on July 31, 1993, in Motril, Spain.
When did Prince Baudouin of Belgium die?
Prince Baudouin of Belgium died on 1891-01-23.
When did Jan Baudouin de Courtenay die?
Jan Baudouin de Courtenay died in 1929.
When did King Baudouin I of Belgium die?
King Baudouin I of Belgium died on July 31, 1993 at the age of 62.
Trending Questions
What jobs do German shepherds do?
What is that violent disturbance in the atmosphere?
What is spiritual tradition?
Is speeding a felony?
Are grow lights harmful to humans and if so, what are the potential risks associated with their use?
How was lineage important to West native African societies?
Why might an author choose t use a first person narrator?
How many starburst candy can fit in a 16 oz jar?
Safeway carries twinkle silver polish?
Is Louis single?
Is there a cheat code for Pokemon ruby to get Rayquaza Groudon or Kyogre as the starters?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Where is the glow plugs on 1999 F250 7.3 diesel?
What is the main concern of the writer?
What happened on April 25th 1994?
How did ladd russo become immortal?
When was LNWR Dock Tank created?
How can I effectively clean and sanitize bath toys, ensuring they are safe for my child to play with?
What is valve class?
What would happen if decomposition did not occur?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.