answersLogoWhite

0

When did Cornelio Villareal die?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Cornelio Villareal died on 1992-12-22.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Cornelio Villareal born?

Cornelio Villareal was born on 1904-09-11.


When did Mitos Villareal die?

Mitos Villareal died in 1995, in Philippines.


When did Emilio Villareal die?

Emilio Villareal died on 2011-09-12.


When did Cornelio Bentivoglio die?

Cornelio Bentivoglio died in 1732.


When did Cornelio Musso die?

Cornelio Musso died in 1574.


When did Cornelio Fabro die?

Cornelio Fabro died in 1995.


When did Cornelio Da Montalcino die?

Cornelio Da Montalcino died in 1554.


When did Cornelio Saavedra Rodríguez die?

Cornelio Saavedra Rodríguez died on 1891-04-07.


When did Enrique Cornelio Osornio Martínez de los Ríos die?

Enrique Cornelio Osornio Martínez de los Ríos died in 1945.


When did Cornelio Reyna die?

Cornelio Reyna died on January 22, 1997, in Mexico City, Mexico of stomach ulcer.


When was Sergio Villareal born?

Sergio Villareal was born in 1986.


When was Leo Villareal born?

Leo Villareal was born in 1967.

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.