answersLogoWhite

0

When did Dean Burk die?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Dean Burk died on 1988-10-06.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Dean Burk born?

Dean Burk was born on 1904-03-21.


When did Sandy Burk die?

Sandy Burk died on 1934-10-11.


When did John Daly Burk die?

John Daly Burk died in 1808.


When did Harvey William Burk die?

Harvey William Burk died on 1907-10-13.


When did Adrian Burk die?

Adrian Burk died on July 28, 2003, in Houston, Texas, USA.


When and where did baseball player Sandy Burk die?

Sandy Burk died October 11, 1934, in Brooklyn, NY, USA.


When did Jim Burk die?

Jim Burk died on March 10, 2009, in Darby, Montana, USA of heart failure.


When did Burk Symon die?

Burk Symon died on February 20, 1950, in Woodland Hills, Los Angeles, California, USA.


When did Jeannine Burk die?

Jeannine Burk is most likely still alive. She was 72 when interviewed in 2011 (born September 15, 1939).


What is the birth name of Adrian Burk?

Adrian Burk's birth name is Adrian Matthew Burk.


What is the birth name of Josh Burk?

Josh Burk's birth name is Joshua David Burk.


How will dean die?

No one knows how Dean will die. It will hopefully be painless and comfortable.

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.