answersLogoWhite

0

When did George Grey Barnard die?

User Avatar

APIBirthday ∙

Lvl 1
∙ 11y ago

George Grey Barnard died on April 24, 1938 at the age of 74.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did George gray Barnard die?

George Grey Barnard died on April 24, 1938 at the age of 74.


What is George Grey Barnard's birthday?

George Grey Barnard was born on May 24, 1863.


When was George Grey Barnard born?

George Grey Barnard was born on May 24, 1863.


How old was George Grey Barnard at death?

George Grey Barnard died on April 24, 1938 at the age of 74.


What is George gray Barnard's birthday?

George Grey Barnard was born on May 24, 1863.


When was George gray Barnard born?

George Grey Barnard was born on May 24, 1863.


How old is George Grey Barnard?

George Grey Barnard was born on May 24, 1863 and died on April 24, 1938. George Grey Barnard would have been 74 years old at the time of death or 152 years old today.


How old is George gray Barnard?

George Grey Barnard was born on May 24, 1863 and died on April 24, 1938. George Grey Barnard would have been 74 years old at the time of death or 150 years old today.


When did George Henry Barnard die?

George Henry Barnard died in 1954.


When did George Alfred Barnard die?

George Alfred Barnard died in 2002.


When did George G. Barnard die?

George G. Barnard died in 1879.


When did George Barnard Baker die?

George Barnard Baker died on 1910-02-09.

Trending Questions
Calculate the molarity of a H3PO4 solution of 6.66 in 555mL of solution? What are treatments for splenic trauma? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? Does logh mean forgive in Gaelic? What is the collect noun for tools? Are phoenix university credits transferable? Where is the Unitarian Universalist Church located? How much solar energy reaches Earth? What is a female monk called in the Chinese language? Which theme can be found in both If and The Jungle Book by Rudyard Kipling? Where is the habitat of Rhizomes? How much are ballet point shoes at a dance school? Is 0.323232 rational? What did George Washington say? What steps can use to protect yourself from cybercrime? The three states of matter are? Is the setting in England for James and the Giant Peach? Was Australia called Australia in 1901? Sleepover games for 18 year olds? What is the denominator of fraction?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.