0
What else can I help you with?
Related Questions
When was George Kenneth Mallory born?
George Kenneth Mallory was born in 1900.
How did gorge mallory die on mt eversst?
It is thought the George Mallory died on Mount Everest in 1924 due to falling.
When was George Mallory born?
George Mallory was born on June 18, 1886.
When was George mallory first found?
The body of George Mallory was found in 1999
When did Mount Everest first appear?
In 1921 by George Mallory In 1921 by George Mallory
Did gorge die on mt everest?
If you mean George Mallory then yes he did die on Mount Everest. It is thought he had a fall.
What has the author George Herbert Mallory written?
George Herbert Mallory has written: 'Boswell, the biographer'
What is George Leigh Mallory's birthday?
George Leigh Mallory was born on June 18, 1886.
Did George mallory have any children?
Frances Clare Beridge Ruth Mallory Robinson, and John George Mallory
How old was George Leigh Mallory at death?
George Leigh Mallory died on June 8, 1924 at the age of 37.
Did malrey die on mount evrest?
George Mallory died on Mount Everest from a fall high up on the mountain.
When did George mallory's body was found?
He was found by humans one day on an mountain.
Trending Questions
What is the difference between a turkey and a chicken?
Why don't you get a shock if you touch the plastic covering of an electric wire?
If the digits of your present age are reversed then you get the age of your son if 1 year ago your age was twice as that of your son find my present age?
Are soods Punjabi?
What is vss on Lincoln continental on 1997?
What are the Yearly Rainfall amounts in Salem Pendleton Eugene Redmond Medford and Lakeview Oregon?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
How can you make a Mazda miata fast?
What best explains why points cannot have a diameter of 0.5 mm?
What continents connected during the ice age?
Is all jack Daniels made in Tennessee?
What is a similarity between a plant root hair cell and an animal small intestine cell?
What is the reaction for Ag plus O2 AgO?
What is the correct method of stopping in in-line skates?
What are some team mascots that begin with the letter T?
Anu anu ang bansang nasakop ng France?
Funnel clouds in a vision or dream?
How to die without hurting yourself?
When did Mount Ruapehu last erupt?
What is specialized agriculture?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.