0
What else can I help you with?
Related Questions
When was Jimmy 'Jammin'' Smith born?
King Jammy was born in 1947.
When did Jimmy Smith - baseball - die?
Jimmy Smith - baseball - died on 1974-01-01.
When and where did baseball player Jimmy Smith die?
Jimmy Smith died January 1, 1974, in Pittsburgh, PA, USA.
Who won the Supercross Championship in 1972?
"Jammin' Jimmy" Weinert was the first one to win the first supercross championship 1972.
When did Jimmy Campbell - musician - die?
Jimmy Smith - musician - died on 2005-02-08.
When was Jammin created?
Jammin' was created on 2001-07-28.
What is the duration of Jammin'?
The duration of Jammin' is 1800.0 seconds.
What is Jimmy Smith's birthday?
Jimmy Smith was born on February 9, 1969.
How tall is Jimmy Smith?
NFL player Jimmy Smith is 6'-02''.
When was Jammin' the Blues created?
Jammin' the Blues was created in 1944.
When was Wynne Jammin' created?
Wynne Jammin' was created in 1980.
When did Jammin end?
Jammin ended on 2008-07-06.
Trending Questions
What are the five highest mountains in the Appalachians and the altitudes?
How do you save panda from extinction?
What is hydrophilic moiety?
What are tHe types of farming in Pakistan?
What was the philosophy followed by William Graham Sumner?
How can I confirm that a house does not contain any asbestos?
How do you delete tap tap account on iPod touch?
Is the Scotch Opening a good choice for players looking to gain an advantage in the opening phase of a chess game?
Where can one purchase a secondhand Toyota Coaster?
How cashe memory work?
Can a cat transmit rabies to their kittens from nursing?
Where is peridotite found in the Earth?
When did man discover the sun moves along its celestial orbit?
How do you set the timing on a 1991 Chevy Suburban R1500 5.7 V8 350ci T.B.I?
How can ears help us walk tightropes?
Where is the nearest cell phone shop?
What is the relative formula mass of lead oxide?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the curb weight of the 2006 BMW 3-Series?
What statement about the 16PF is false?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.