0
What else can I help you with?
Related Questions
When was John Milton Thayer born?
John Milton Thayer was born on 1820-01-24.
When did John R. Thayer die?
John R. Thayer died on 1916-12-19.
Did Milton Long survive?
Milton long did die. And fun fact jack thayer and Milton long both said goodluck to each and jumped down to the water together.
When did John Milton Glover die?
John Milton Glover died in 1929.
When did John Milton Harney die?
John Milton Harney died in 1825.
When did John Milton Earle die?
John Milton Earle died in 1874.
When did John Milton Roberts die?
John Milton Roberts died in 1990.
When did John Milton Miller die?
John Milton Miller died in 1962.
When did John Milton Elliott die?
John Milton Elliott died in 1879.
When did John Milton - composer - die?
John Milton - composer - died in 1647.
When did John Milton Mackie die?
John Milton Mackie died in 1894.
When did John Milton Gregory die?
John Milton Gregory died in 1898.
Trending Questions
Did frank Sinatra smoke?
How tall is 151 cm in feet?
What is the Italian translation of 'to stay safe'?
What states have a town named Trenton?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What does it mean if someone says it smells like a balls?
How old is Scrooge when he worked for Fezziwig?
What is the name of a famous trombonist?
What are measurements of hulk hogan's biceps?
How long does it take to fly between Vancouver BC and Saudia Arabia?
What are the coefficient in 3Mg N2 - Mg3N2?
How did George Washington feel about his hometown or country?
How long earth take to revolve around sun?
Does Sydney have a nuclear power station?
What is RESH in metar?
Where is the exact location of registry of deeds in taguig?
How does a musher control his sled team?
What is electromagnetic printers?
What are two virtues that Thomas Garrett and Harriet Tubman have in common?
Who is Mr.Guillaume and he was the prime minister of Haiti before Evans Paul?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.