answersLogoWhite

0

When did Max Dill die?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Max Dill died on November 21, 1949, in San Francisco, California, USA.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Max Dill born?

Max Dill was born on September 15, 1876, in Cleveland, Ohio, USA.


When did Howard Dill die?

Howard Dill died in 2008.


When did Dill Jones die?

Dill Jones died in 1984.


When did Danny Dill die?

Danny Dill died on 2008-10-23.


When did John Dill die?

John Dill died on 1944-11-04.


When did William L. Dill die?

William L. Dill died in 1952.


When did Walter Dill Scott die?

Walter Dill Scott died in 1955.


When did Clarence Dill die?

Clarence Dill died on 1978-01-14.


When did Nicholas Bayard Dill die?

Nicholas Bayard Dill died in 1993.


When did Thomas Melville Dill die?

Thomas Melville Dill died on 1945-03-07.


When did Annie Scott Dill Maunder die?

Annie Scott Dill Maunder died in 1947.


What movie and television projects has Max Dill been in?

Max Dill has: Played Mike in "Bluff" in 1916. Played Mike in "The Three Pals" in 1916. Played Mike in "Lonesome Town" in 1916. Played Mike in "A Million for Mary" in 1916. Played Mike Amsterdammer in "Beloved Rogues" in 1917. Played Mike Plotts in "Glory" in 1917. Played Dill - of Kolb and Dill in "Two Flaming Youths" in 1927.

Trending Questions
How do you test 4 wire PT100 temperature sensor RDT? How many amendments in South Carolina's constitution? What are the three most important gods in Hinduism? How long is the flight from Melbourne Australia to the Caribbean? What is 4.28 to the nearest tenths? Can you drink energy drinks with lisinopril? How much should i charge to paint a mailbox? How are hydrographs useful to hydrologists? Once a sedative and cure for nervous tension the ion of this element is now a trite or commonplace expression? how can i make 10 using nine 9s? What is Honduras coin? What is the difference between Romanticism and Naturalism? What time of year did the thylacine breed? What is the balanced chemical equation of HCl and C6H8O7 Citric Acid? Where is the heater control valve located on your 1994 e 150 van? What is the meaning of 'virsa' in Punjabi language? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? Where does Ariana Grande get her purple giraffe? What is the classification of a triangle with sides of length 5 inches 12 inches and 13 inches? What is the subscript of sodium chloride?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.