0
Nelson Mandela got out of jail on February 11 1990
What else can I help you with?
Related Questions
When Nelson Mandela came out of jail what did he do?
mandela came out of the jail when south africa got independence from the white minorities.
When Nelson Mandela got to jail what did he cut open?
limestone
What did nelson Mandela do when he got released from jail?
he went home
What was Nelson Mandela's age when he got out of jail?
He was 78 years old.
What year was Nelson Mandela realesed from jail?
nelson mandela was realesed in february 11 1990
When did Mandela get life long jail?
Nelson was sentenced to life in prison in 1962 but got out of jail in 1990 as rights for coloured people came about.
What happened to nelson Mandela?
He was put into jail.
Who supports Nelson Mandela while in jail?
I do
Did nelson died in jail?
Do you mean Nelson Mandela? He was released from jail in 1990 and is still living. Or do you mean another Nelson?
When was Nelson Mandela released from jail?
Nelson Mandela was released from jail on February 11, 1990.
What did nelson Mandela say after he was released from jail?
when nelson Mandela got out of jail he went on the election list to be presendent of south Africa, lots of black people queued for days just to vote for him
What jail did Nelson Mandela go to?
Robben Island.
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.