0
Peter Bruni died on May 3, 1992, in Los Angeles, California, USA of heart failure.
What else can I help you with?
Related Questions
What is the birth name of Peter Bruni?
Peter Bruni's birth name is Mario Vincent Peter Bruni.
When was Peter Bruni born?
Peter Bruni was born on December 28, 1931, in Massachusetts, USA.
When did Domenico Bruni die?
Domenico Bruni died in 1666.
When did Giulio Bruni die?
Giulio Bruni died in 1615.
When did Fyodor Bruni die?
Fyodor Bruni died in 1875.
When did Leonardo Bruni die?
Leonardo Bruni died in 1444.
When did Bruni d'Entrecasteaux die?
Bruni d'Entrecasteaux died on 1793-07-21.
When did Antonio Bartolomeo Bruni die?
Antonio Bartolomeo Bruni died in 1821.
When did Georgina Bruni die?
Georgina Bruni died on 2008-01-19.
When did Gustavo Maria Bruni die?
Gustavo Maria Bruni died on 1911-02-10.
When did Sergio Bruni die?
Sergio Bruni died on June 22, 2003, in Rome, Lazio, Italy.
When did Livio Bruni die?
Livio Bruni died on December 6, 2003, in Terespolis, Rio de Janeiro, Brazil.
Trending Questions
What is Harry Styles from one direction favorite football team?
Is Utah Nevada Idaho and Western Colorado are all part of the Western Frontier?
What is the ratio for a visage from King Black Dragon?
How old where people when they joined world war 2?
How much should a 4'6 8 year old boy weigh?
What does the word mean having to do with community worship?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What are codes called when procedures are grouped together?
When was Charles S. Kaelin born?
What is the law in Texas about children riding in the front seat of a vehicle?
What happened to miners and towns when the gold ran out?
Do organelles use energy from sunlight to produce food are called mitochondria?
What are five methods of nomination used today include?
How much work will be needed to lift a block weighin 4 newtons and a distance of 10 meters?
How old do you have to be to get a tattoo in Missouri if you already have one?
Have Holly Willoughby and Stephen Mulhern ever dated?
What tectonic plates does the eyjafjallajokull sit on?
How much transmission fluid do you need to change in a 1991 Toyota Land Cruiser?
What historical events happened in 1933?
What are the 5 odd numbers whose sum is 50 from 1 to 49?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.