0
What else can I help you with?
Related Questions
When did Maurice Richard Josey die?
Maurice Richard died in 2000
When was Richard Josey born?
Richard Josey was born in 1840.
When was Maurice Richard Josey born?
Maurice Richard Josey was born in 1870.
When did Alex Josey die?
Alex Josey died on 1986-10-15.
When did E. J. Josey die?
E. J. Josey died on 2009-07-03.
Did Clint eastwood die the movie josey wales movie?
No, Clint Eastwood's character, Josey Wales, does not die in the movie "The Outlaw Josey Wales." Instead, he survives the events of the film, which follows his journey of revenge and redemption after the Civil War. The film ends with Wales finding a sense of peace, suggesting he continues to live on.
In real life not the movie how did outlaw Josey Wales die?
He died from a tick bite
How tall is Josey Rodriguez?
Josey Rodriguez is 5' 9".
How tall is Zen Josey?
Zen Josey is 5' 6".
When was Josey Little born?
Josey Little was born in 1821.
When was Henry Josey born?
Henry Josey was born in 1992.
What nicknames does Josey Pickering go by?
Josey Pickering goes by JJ.
Trending Questions
What kind of containers are used to hold palmas at temperatures of millions of degrees?
What are the dimensions of a flatbed rail car?
When president Rutherford B. Hayes attacked the practice of patronage his supporters were called?
What did the united states join the allies and help to win world war 2?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What is perpendicular to the line 3x plus y equals 2?
Why is counseling important and what is done in that area?
What is a line on which numbers are assigned to points callled?
Can 35mm film go through TSA security screening?
How do you covert 19 divided by 7 into a mixed number?
How do you say calf in french?
Does antone have Answers to study link 2.2 number hunt?
Where is the windshield washer pump on a 1996 Dodge Ram 1500 Truck and how do you replace it?
What was the first cereal used by man?
What is the atomic number based on in the nucleus?
Can Muslim's eat venison?
What is the future of safety matches?
Why would a heater turn on and off on its own?
What is the name of the woody stem of a raspberry shrub?
What is 781679 rounded to the nearest hundred?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.