0
What else can I help you with?
Related Questions
When was Richard Seuss born?
Richard Seuss was born on 1897-08-28.
What book by Dr. Seuss is about President Richard Nixon?
Marvin K. Mooney, Will You Please Go Now! (He modified it to Richard M. Nixon...)
Where did Dr. Seuss die at?
la jolla California
How did Dr Seuss's dad die?
He killed himself.
What state did Dr. Seuss die in?
Dr.suess's real name was theodor Seuss Geisel and he died in la jolla California
In what year did Dr. Seuss die?
September 21 1991
What caused Dr Seuss's first wife to die?
Suicide
How did Dr Seuss sister die?
took a poo and got stuck
When did Dr Seuss's sister die?
no one really noes how she died
How did Theodor Seuss Geisel die?
Theodor Seuss Geisel died in his sleep from oral cancer on September 24, 1991, aged 87.
When did Dr. Seuss die and what did he die from?
Thedor Suess Geisal died from Thorat cancer in 1991 in La,Jolla California at the age of 87
Does buckingham die in Richard III?
Yes, he does die by Richard
Trending Questions
Where should a seven branched menorah be placed?
Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint?
Remove the front door speaker landcruiser?
How high did sputnik go up?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Which describes an aspect of total war as it was practiced during the Civil War?
What is the Irish Gaelic for 'fire earth metal water and wood'?
How can cactus be more useful than a rose?
What do governments do to stabilize the economy?
What are the harmul affects oxycodeine?
What is 10 percent of 650000?
Can you use frozen vegetables that have thawed?
How do you get a Disney copyright permission?
How do you round 735901 to nearest hundred thousand?
What is the 2013 murder capital?
What maths do you need to know to become an electrician?
Calculate heat of fusion?
Why some of the word use ed at the end of a word?
Can cocci bacteria be found in animals?
Timely filing limit for blue cross in Texas?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.