answersLogoWhite

0

When did Rolf Schock die?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Rolf Schock died in 1986.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Rolf Schock born?

Rolf Schock was born in 1933.


When was Rolf Schock Prizes created?

Rolf Schock Prizes was created in 1993.


When did Rolf Lefdahl die?

Rolf Lefdahl died in 1965.


When did Rolf Blomberg die?

Rolf Blomberg died in 1996.


When did Rolf Solem die?

Rolf Solem died in 2011.


When did Rolf Stein die?

Rolf Stein died in 1999.


When did Rolf Aas die?

Rolf Aas died in 1946.


When did Rolf Moe die?

Rolf Moe died in 1999.


When did Rolf Schild die?

Rolf Schild died in 2003.


When did Rolf Faste die?

Rolf Faste died in 2003.


When did Rolf Johannessen die?

Rolf Johannessen died in 1965.


When did Rolf Smedmark die?

Rolf Smedmark died in 1951.

Trending Questions
What is the longest lasting chinese dynasty? What kind of science does anatomist study? How much do the city council members get paid? How did the colonies avoid paying the heavy taxes on British goods? What is the positive difference between the number of large apples and the number of small apples in the small bushel of apples Megan purchased? How many belgium 12 gauge auto 5 s were produced? How many quarts does a 3.0L 2008 Ford Ranger take? What is the driving distance between akron Ohio and alliance Ohio? Got a ticket less than a year ago in Ohio and live in California and my insurance went up is it too late go to traffic school? What are the chances for Japan to surrender in World War before the bombing of Hiroshima and Nagasaki? What are the underwriting considerations for marine cargo insurance? Where is the Halo 3 skull 14 location? What did popcap create? Are the minerals which appear in metamorphic rocks largely the same as those in igneous rocks? What are the torque specs for a Geo Metro front wheel bearings? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What order should you use to list your sources in a bibliography? What year is your robbins Myers fan list no 5304? What three sectors must be included when studying the classical period? How do you know your philhealth number?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.