0
Rudy Larriva died on February 19, 2010, in Irvine, California, USA.
What else can I help you with?
Related Questions
When was Rudy Larriva born?
Rudy Larriva was born on February 12, 1916, in El Paso, Texas, USA.
When did Guadalupe Larriva die?
Guadalupe Larriva died in 2007.
When did Enriqueta Arvelo Larriva die?
Enriqueta Arvelo Larriva died in 1963.
How tall is Tito Larriva?
Tito Larriva is 5' 9".
When was Guadalupe Larriva born?
Guadalupe Larriva was born in 1956.
When was Enriqueta Arvelo Larriva born?
Enriqueta Arvelo Larriva was born in 1886.
What has the author Enriqueta Arvelo Larriva written?
Enriqueta Arvelo Larriva has written: 'Voz aislada (poemas 1930-1939)'
When did Rudy Burckhardt die?
Rudy Burckhardt died in 1999.
When did Rudy Miller die?
Rudy Miller died in 1994.
When did Rudy Salud die?
Rudy Salud died in 2011.
When did Rudy Ivan die?
Rudy Ivan died in 1982.
When did Rudy Lewis die?
Rudy Lewis died in 1964.
Trending Questions
What is a Crackin?
What is the mean of 2 6 9 7?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What are powers directly stated in the constitution called?
What is the cpt code for deviated septum?
What are the advantages and disadvantages of modern n traditional tools?
Is shelter a problem in Uganda?
What is the Hawaiian word for muffin?
Was the Mexican War a defensive war or a war of aggression?
How do you simplify fractions such as 2 over 6?
Where is the pineal body found?
What is the medical term for protrusion of the eye?
Where can one find HSBC bank branches in the UK?
Who are the people in the illiminati?
How do you stop ruining the bottom of your shoes?
How does the elevation affect the climate in mesoamerica?
Where does the African leopard shelter?
How long does it take a hyperscan from the us get to Spain?
Who is the main star in the Rascal Flatts video?
Where can you watch Sugar Sugar Rune episode 36 in English subtitles?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.