0
What else can I help you with?
Related Questions
When was Thure Johansson - wrestler - born?
Thure Johansson - wrestler - was born in 1912.
When did Thure Hellström die?
Thure Hellström died in 1930.
When did Thure Lindgren die?
Thure Lindgren died in 2005.
When did Thure Ahlqvist die?
Thure Ahlqvist died in 1983.
When did Thure Andersson die?
Thure Andersson died in 1976.
When did Thure Sjöstedt die?
Thure Sjöstedt died in 1956.
When did Thure Holm die?
Thure Holm died in October 1932.
When did Thure Kumlien die?
Thure Kumlien died on 1888-08-05.
When did Torsten Thure Renvall die?
Torsten Thure Renvall died in 1898.
When did Thure de Thulstrup die?
Thure de Thulstrup died in 1930.
When did Thure von Uexküll die?
Thure von Uexküll died in 2004.
When did Thure Bahne die?
Thure Bahne died on January 28, 1956.
Trending Questions
Why should grizzly bears stay in zoos?
Is a person's deceased step-mother's deceased brother's living spouse any relation to them or their father at all?
How long is flight time from Las Vegas to Houston?
Who plays the boy Miley Cyrus likes in her new movie?
Where is the syllable break in the word behind?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
A word that starts with the letter i in french?
What if a auto parts stroe gives a discount to 14 of every 100 shoppers. what percent of the shoppers receive a discount?
Why 24 carat gold is not suitable for making jewelry?
When did Alessandro Momo die?
Is Janice Dickinson a lesbian?
How can you get two accounts on Horseisle with the same internet connection?
Why do some people have to pee more often than others?
Covert 5 foot 2 to meters?
What is the past tense of glad?
Can moringa seed be used to cure fibroid?
The sum of eight times a number and seven is twice the number?
What is the main difference of Bunsen burner to alcohol lamp?
What is the literacy rate of Dubai?
How did blind fury go blind?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.