0
What else can I help you with?
Related Questions
When musicians make up their own music its called?
When Musicians write their own music it's called...Composing Music
How did Ludwig Van Beethoven start his career on composing?
Beethoven began composing works of music when he was ten years old.
How can I learn music composing effectively?
To learn music composing effectively, you can start by studying music theory, practicing regularly, analyzing compositions by other musicians, experimenting with different styles and techniques, seeking feedback from experienced composers, and continuing to learn and grow as a musician.
When did beethoven start composing?
he started composing at like age 7.5.
When did lady gaga start composing her music?
She started composing it when she was 18 x
When did Felix mendelssohn start composing?
20 yrs oldthat'swhen he started composing
When did schoenberg start composing?
he did i't in 1923
When did composers start composing?
In the early 1500.
What age did Frederick Chopin start composing?
13
When did Bob Marley start composing music?
rawer
why did joseph haydn start composing?
to be like beethoven
When did Andrew Lloyd webber start composing?
i dont really no
Trending Questions
Tattoos that represent travel?
Which of the events was most influential in bringing the US into the world war 2?
What were the elements and functions of god myths?
Give two types of evidence for continental drift with an example of each type?
When you rate their depression on a scale from 1-10. their response are what in your study?
What is the distance between the points (1 -2) and (-93) on a grid?
Why were marriages arranged in Shakespeare's time?
Why does carbon conduct electricity if it is a non metal?
What should you do if the application of one Combat Application Trouniquet does not stop bleeding?
What is minimum age of a imam?
Would mung bean grow without water?
How many amps does a one horse power motor draw?
How long will it take to run 1.5 miles at 7 miles per hour?
Is sign language a forgen language?
What language do Wales people talk?
What is a catchy title for a science fair project on heat?
What words have the same vowel sound as the word ground?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the common name for the spine?
How many people use health app from their cell phone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.