answersLogoWhite

0

When did turtles live in water?

User Avatar

Anonymous

∙ 13y ago
Updated: 4/8/2020

turtles still live in water but not all turtles.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Where are turtles?

water turtles live in the water land turtles live in the land


How do turtles breathe in water or not?

Turtles live in the water. How can they not breath in what they live in?!


Do turtles live in a box?

Turtles can live anywhere. Some live in water.


Why do turtles need water to live?

All animals need water to live. Turtles are animals.


Can eastern box turtles live in salt water?

Box turtles live on land not in water


Do snapping turtles live in fresh or salt water?

Snapping turtles live in fresh water


What type of water do green sea turtles live in?

Green sea turtles live in salty water.


Do all turtles live by the water?

No some are desert tortoises and such, so not all turtles live by water


Where do turtles live in?

In the water.


What kind of turtles live in salt water?

Snapping turtles


Can eastern box turtles live in water?

No. technically, tarapins are land creatures and turtles live in a water environment (i.e. loggerhead turtles, snapping turtles)


Is this true turtles only live in the sea?

No. Turtles live in the ocean, in fresh water, or on land.

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.