0
What else can I help you with?
Related Questions
What systems does UFC come out on?
PlayStation 3 Xbox 360
Is the UFC making any video games for xbox 360?
As of Oct. 09, UFC: Undisputed is on the Xbox 360.
Will UFC Undisputed 2010 come to Wii?
No, it's only out on PS3, PSP and Xbox 360.
Is UFC out on xbox 360?
Not yet, its out on 5/19/09
Is there a UFC game for xbox 360?
Yes. Currently the only one available is UFC: Undisputed 2009.
Do they have UFC undisputed 2009 for ps2?
No it is a PS3 Xbox 360 game
For what game systems is the the UFC game out for?
i know for sure xbox 360 and ps3
Is UFC undisputed 2010 out for playstation 2?
No PSP PS3 and Xbox 360
What is the song for UFC unleashed?
Face the Pain is the theme song for UFC Unleashed. UFC Unleashed is a TV show that appears on the Spike TV channel.
What are the release dates for UFC Unleashed - 2005?
UFC Unleashed - 2005 was released on: USA: 25 July 2005
Will UFC undisputed 2010 be in ps2?
no. only ps3 and xbox 360. sorry.
What are the release dates for UFC Unleashed - 2005 Women?
UFC Unleashed - 2005 Women was released on: USA: 2 March 2014
Trending Questions
Is there a recall on 2006 PT cruiser?
Where do you go to get a permit to put up a fence in LA?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp?
Which Ohio State Football player is called Animal?
Worsted system and woolen system?
What is another name for a tire's height?
How many days old are you today if you were born March 8 1949?
Is ohm's law applicable to ac or dc and why?
Son and daughter of Ferdinand Magellan?
How big is Selena gomez's mole?
What is the value of a 2003 US dollar coin?
Animals in trenches?
Does Minnesota have tolls on its roads?
What is 147 square feet converted to square meters?
Is this statement true premiums for term life insurance decrease as people get older?
What should I do if my toilet has a weak flush?
When was Mann Kee Awaaz Pratigya created?
What is the recipricol of 7654321?
What is the unit price of a product?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.